EQUINOX LIBRARY AMPLIFICATION KITS
Precision amplified
Equinox® Library Amplification Kits deliver excellent fidelity, uniform sequence coverage, and high library complexity to specifically address the stringent demands of applications such as rare variant detection, circulating cell-free DNA (cfDNA) analysis, single-cell analysis, and hybridization capture. Kits contain a uniquely engineered, ultra-high fidelity DNA polymerase in an optimized hot start PCR mix formulated for high efficiency, low-bias NGS library amplification.
Key Features and Benefits
- Increase overall assay sensitivity with ultra-high-fidelity amplification, reducing misincorporation events by up to 40%
- Improve sequencing economy with highly uniform sequence coverage
- Amplify libraries efficiently from a wide range of inputs (0.1 pg – 500 ng) and GC content (15% to 85%)
- Enable low-input applications and automated workflows with a highly effective antibody-based hot start formulation
- Compatibility with paramagnetic beads delivers robust performance in hybridization capture workflows
- Amplify bisulfite-converted DNA with Equinox Uracil Tolerant Library Amplification Kits
Applications
- Low-frequency variant detection NGS assays, including those utilizing challenging samples such as FFPE and cfDNA
- Hybridization capture workflows
- Single-cell analysis
- Whole genome sequencing
- Amplicon sequencing
- RNA-Seq
- ChIP-Seq, ATAC-Seq, and associated epigenetic applications
- Illumina and non-Illumina sample preparation workflows
Equinox Uracil Tolerant Library Amplification Kits are specifically designed for the amplification of:
- Bisulfite-converted DNA
- Damaged DNA samples or templates containing modified bases
Flexible Kit Configurations
Equinox Library Amplification Kits are designed for high-efficiency, high-fidelity amplification of next generation sequencing (NGS) libraries. The ready-to-use mix contains an optimized PCR buffer and hot start enzyme formulation that enables library amplification with minimal bias and error across a broad range of input amounts and GC content, and performance is maintained in the presence of a variety of paramagnetic beads.
Three different Equinox Library Amplification Kits are available, each available with or without amplification primers:
| The Equinox Library Amplification Kit supports highly sensitive applications with our ultra-high-fidelity polymerase in a convenient 2X master mix format | |
| The Equinox HC (High Concentration) Library Amplification Kit provides a more concentrated (4X) master mix, for library amplification reactions from more dilute inputs | |
| The Equinox Uracil Tolerant Library Amplification Kit enables amplification of uracil-containing templates including bisulfite-converted, deaminated, or damaged (e.g., FFPE) DNA |
The Equinox Library Amplification Kit supports highly sensitive applications with our ultra-high-fidelity polymerase in a convenient 2X master mix format | |
The Equinox HC (High Concentration) Library Amplification Kit provides a more concentrated (4X) master mix, for library amplification reactions from more dilute inputs | |
The Equinox Uracil Tolerant Library Amplification Kit enables amplification of uracil-containing templates including bisulfite-converted, deaminated, or damaged (e.g., FFPE) DNA |
Key Performance Data
Library amplification with Equinox® enables rare mutation detection
Ultra-high-fidelity library amplification is critical for sensitive applications. Equinox is a proprietary proofreading polymerase, capable of a 40% reduction in overall polymerase error rate in comparison to KAPA HiFi HotStart ReadyMix. This enables sensitive variant detection by minimizing overall error rates and reducing false variant calls. A significant reduction in C>T substitutions is particularly important as this mutation is associated with the spontaneous deamination of methylated cytosine to uracil, and is also one of the most common mutation types in cancers.


Figure 1. Up to 40% reduction in overall ... MORE
Library amplification with Equinox enables rare mutation detection


Figure 1. Up to 40% reduction in overall polymerase error rate. Error rates of the Equinox Amplification Master Mix and KAPA HiFi HotStart ReadyMix were measured after >9 million base incorporation events in three separate reactions, using a proprietary NGS-based assay. Base substitution profiles were examined in triplicate over 5.4 million G/C incorporation events and 4.0 million A/T incorporation events. Equinox displayed an overall polymerase error rate 40% lower than that of KAPA HiFi HotStart ReadyMix™.
Low-bias amplification delivers uniform UMI family coverage
Unique Molecular Indices (UMIs; also known as molecular barcodes) are added to sequencing libraries prior to PCR amplification to enable accurate bioinformatic identification of PCR duplicates and improve variant calling in low-input applications. Biased amplification – the preferential amplification of a small number of molecules at the expense of others – results in uneven UMI family representation. This generates large numbers of singleton UMIs (families represented by only one read) that cannot be error corrected. A significant amount of additional sequencing may be required to attain requisite coverage of low abundance sequences. Equinox enable uniform UMI family amplification, supporting coverage for >75% of all read families (and >90% of read families with GC content from 25 – 75%) within 3X of the mean family depth.
Figure 2A. Low-bias UMI amplification ... MORE
Figure 2B: UMI family coverage impacts ... MORE
Low-bias amplification delivers uniform UMI family coverage
Figure 2A. Low-bias UMI amplification. Human whole-genome libraries were prepared using UMI adapters. A limited amount of template (80,000 library molecules, quantified by qPCR) were amplified for 26 cycles using the Equinox Library Amplification Kit, KAPA HiFi HotStart ReadyMix, or NEB 2X Taq Master Mix. Sequencing was performed on an Illumina® NovaSeq™ instrument, and data were subsampled to 9 million clusters. With Equinox, coverage was obtained for >75% of all read families (and >90% of read families with GC content from 25–75%) within 3X of the mean family depth. The ‘ideal’ line indicates completely uniform coverage across UMI families modeled with a Poisson distribution.
Figure 2B: UMI family coverage impacts error correction. Graphical representation of how ‘jackpotting’ (i.e., preferential amplification of a small subset of molecules) impacts the overall ability to error-correct when using UMIs in sensitive sequencing applications. Overamplification of certain molecules with wildtype Taq results in insufficient coverage of others. This reduces the overall number of error-correctable molecules.
Effective hot start formulation safeguards low-input applications and automated workflows
The Equinox Amplification Master Mix is formulated with a highly effective hot start antibody that strongly inhibits both the 5’→ 3’ polymerase and 3’ → 5’ exonuclease activities of the enzyme This mitigates degradation of primers and low-input samples, and minimizes artifacts resulting from nonspecific amplification – thereby improving sensitivity in automated library construction.


Figure 3. Improved hot start functionality ... MORE
Effective hot start formulation safeguards low-input applications and automated workflows


Figure 3. Improved hot start functionality. Polymerase and exonuclease activities of Equinox polymerase, KAPA HiFi HotStart DNA Polymerase, and NEBNext Q5 DNA Polymerase were assessed by the detection of dNTP incorporation or dNMP release, respectively, after incubation at 25°C. Percent inhibition is reported relative to uninhibited formulations.
High-efficiency amplification limits bias and artifacts
High-efficiency library amplification with Equinox makes it possible to limit the number of cycles needed to generate the yield needed for downstream steps. Amplification efficiency remains robust, even when yields >1 μg are required. This minimizes PCR-associated bias and artifacts for applications such as single-plex hybridization capture.


Figure 4. Highly efficient library amplification ... MORE
High-efficiency amplification limits bias and artifacts


Figure 4. Highly efficient library amplification. Human whole genome libraries (10 ng per reaction) were amplified in triplicate with the Equinox Library Amplification Kit, KAPA HiFi HotStart ReadyMix, and NEBNext Ultra II Q5 Master Mix for 0, 2, 4, 6, 8, 10 or 12 cycles. Yields were determined by qPCR-based library quantification at the 2-cycle intervals.
Uniform amplification improves sequencing economy
PCR bias is exacerbated when working with challenging conditions or samples. Equinox introduces minimal amplification bias, even in the presence of paramagnetic beads. This simplifies protocols that benefit from on-bead amplification, such as hybridization capture workflows. Additionally, Equinox delivers even coverage uniformity across complex genomes which can reduce the amount of sequencing needed to achieve desired coverage depths.
Figure 5A. Highly uniform sequence coverage in ... MORE
Figure 5B. Highly uniform sequence coverage in ... MORE
Uniform amplification improves sequencing economy
Figure 5A. Highly uniform sequence coverage in the presence of paramagnetic beads. Very low amounts (0.04 pg) of adapter-ligated human whole genome libraries were amplified for 26 cycles with the Equinox Library Amplification Kit in the absence or presence of types of paramagnetic beads commonly used in NGS sample preparation workflows: AMPure XP Reagent (100 μL slurry; used for reaction purification) and Dynabeads™ M270 streptavidin beads (500 μg; used in hybridization capture workflows). Coverage data were normalized to those for unamplified libraries. Blue lines represent locally weighted smoothed (LOESS) normalized coverage, whereas red lines represent the density of windows at each GC stratum.
Figure 5B. Highly uniform sequence coverage in the presence of paramagnetic beads reduces dropout. Libraries were prepared from a mixed microbial sample (composed of the genomic DNA of Plasmodium falciparum, mean %GC = 19.4, and Pseudomonas aeruginosa, (mean %GC = 66.1) and amplified with the Equinox Library Amplification Kit or KAPA HiFi HotStart ReadyMix in the presence of AMPure XP Reagent or Dynabeads™ M-270 streptavidin beads. The lower Equinox AT_DROPOUT rate (Picard metric) suggests superior amplification of extremely AT-rich sequences. GC_DROPOUT rates were negligible for both polymerases.
Robust amplification of uracil-containing templates
Many proofreading (B-family) polymerases stall replication in response to uracil or other modified bases in DNA templates. Equinox Uracil Tolerant Polymerase is an engineered polymerase that utilizes uracil-containing templates with high efficiency. This ensures high yields and minimal bias when amplifying bisulfite treated DNA for epigenetic applications.


Figure 6. Equinox Uracil Tolerant Library Amplification ... MORE
Robust amplification of uracil-containing templates


Figure 6. Equinox Uracil Tolerant Library Amplification Kits efficiently amplify uracil-containing templates. As expected, Equinox Library Amplification Kits were inhibited by uracil-containing primers, while Equinox Uracil Tolerant Library Amplification Kits show no inhibition across a range of inputs.
BROCHURES
Equinox Library Amplification Kits Brochure
Element Illumina Singular Ultima DNA RNA FFPE Microbial DNA NGS Equinox Library Amplification Equinox Uracil-Tolerant Library AmplificationEquinox® Library Amplification Kits offer ultra-high-fidelity DNA polymerase in a hot start PCR master mix, ensuring high-efficiency, low-bias NGS library amplification across diverse inputs and GC content.
Precision Enzymes and Proteins Brochure
Custom Genomic Solutions Enzymes MDx DNA Polymerase I Equinox Library Amplification Equinox Uracil-Tolerant Library Amplification phi29 DNAP RNase Inhibitor RNase H StellarScript RT StellarScript HT RT StellarScript HT+ RT StellarTaq DNA Polymerase T4 DNA Ligase T4 DNAP T4 Polynucleotide Kinase T4 Gene 32 Protein Taq DNAPWatchmaker Genomics offers a portfolio of precision-engineered enzymes and proteins, designed to meet the demands of high-stringency applications. We provide tailored services such as custom fills, formats, packaging, and labeling to accommodate unique specifications.
Custom Genomic Solutions Brochure
Custom Genomic Solutions Isothermal Amplification Pathogen Detection PCR/qPCR Rolling Circle Amplification RT-PCR/RT-qPCR Enzymes MDx Equinox Library Amplification Equinox Uracil-Tolerant Library Amplification phi29 DNAP RNase Inhibitor RNase H StellarScript RT StellarScript HT RT StellarScript HT+ RT StellarTaq DNA Polymerase T4 DNA Ligase T4 DNAP T4 Polynucleotide Kinase T4 Gene 32 Protein Taq DNAP Bsu DNA Polymerase, Large Fragment Recombinase Polymerase Amplification (RPA) T4 UvsX DNA Recombinase T4 UvsY ProteinWhether you need small-scale modifications or a fully custom solution, Watchmaker’s flexible model ensures you get exactly what you need — with speed, simplicity, and scientific precision.
VIDEOS
Overcoming sequencing artifacts to fuel clinically relevant NGS applications
Illumina DNA DNA NGS DNA Library Prep with Fragmentation Equinox Library AmplificationThis video covers the data quality and workflow improvements made as a result of implementing the Watchmaker DNA Library Prep Kit with Fragmentation - including reduced sequence artifacts and PCR errors, as well as increased scalability.
POSTERS
Evaluation of library amplification systems for high stringency applications
Illumina DNA DNA NGS Equinox Library AmplificationThis poster evaluates the Equinox Library Amplification Kit's performance in high-stringency applications, emphasizing its efficiency across a broad range of GC contents (20.8% to 80.9%) and its ability to amplify long library inserts without bias. The kit maintains amplification efficiency even as product accumulates, which is crucial for hybridization capture workflows. Additionally, Equinox generates uniform Unique Molecular Index (UMI) families, enhancing sequencing economy and error correction. It also exhibits excellent fidelity and near-complete hot start inhibition of both polymerase and exonuclease activities, making it suitable for automated library amplification.
PROTOCOLS
Equinox Library Amplification Kits User Guide
DNA NGS RNA NGS Equinox Library Amplification Equinox Uracil-Tolerant Library AmplificationProtocol for Equinox® Library Amplification Kit which deliver high-efficiency, low-bias NGS library amplification with hot-start enzymes, supporting broad inputs and various sequencing applications.
Not seeing the full table? Rotate your phone to view in landscape mode.
| Equinox Library Amplification Kits | Equinox High Concentration (HC) Library Amplification Kits | Equinox Uracil Tolerant Library Amplification Kits | |
|---|---|---|---|
| Kit contents | Equinox® Amplification Master Mix (2X) | Equinox Amplification Master Mix (4X) | Equinox Uracil Tolerant Amplification Master Mix (2X) |
| P5/P7 Primer Mix (10X, optional) | P5/P7 Primer Mix (10X, optional) | P5/P7 Primer Mix (10X, optional) | |
| Concentration | 2X | 4X | 2X |
| Shipping conditions | Ice packs | ||
| Storage | Long term: -20°C, ±5°C Short term: 4°C for up to 2 weeks | ||
| Stability | 20 freeze-thaw cycles | ||
| Shelf life | (24 rxn): ≥ 6 months (> 24 rxn): ≥ 12 months | ||
What are the main applications for the Equinox Library Amplification Kit?
Our Equinox® Library Amplification Kit has been specifically optimized for efficient NGS library amplification from a wide range of template amounts (0.1 pg – 500 ng) up to 1 kb in length. These NGS applications include:
- Low-frequency variant detection NGS assays, including those utilizing challenging samples such as FFPE and cfDNA
- Hybridization capture workflows
- Single-cell analysis
- Whole-genome sequencing (WGS)
- RNA-Seq
- Amplicon sequencing
- ChIP-Seq, ATAC-Seq, and associated epigenetic applications
- Illumina and non-Illumina sample preparation workflows
What are the main applications for the Equinox Uracil Tolerant Library Amplification Kit?
- Amplification of bisulfite-converted DNA
- Amplification of damaged DNA or templates containing modified bases
What type of enzyme is in the Equinox Library Amplification Kit?
Equinox DNA Polymerase is an engineered B family proofreading polymerase variant developed specifically for NGS applications to deliver excellent fidelity, uniform sequence coverage, and high library complexity.
What type of enzyme is in the Equinox Uracil Tolerant Library Amplification Kit?
Equinox Uracil Tolerant DNA Polymerase is a proprietary proofreading polymerase specifically engineered to utilize templates that contain uracil or other modified bases. Unlike most B-family DNA polymerases, it does not stall when encountering a modified residue, thereby enabling efficient amplification and high yields of bisulfite converted and damaged DNA.
What is the difference between 2X and 4X Equinox Library Amplification Master Mixes?
The 2X and 4X formulations of Equinox Library Amplification Master Mix result in the same final concentration of enzyme, dNTPs, and buffer components when used at 1X working concentration. However, the volume of master mix required for a standard reaction is 50% less when working with a 4X kit. This leaves more space for dilute templates. The two formulations are expected to perform the same when used with the same template according to standard recommendations.
Can the Equinox Library Amplification Kit amplify longer templates?
Equinox Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.
Can the Equinox Uracil Tolerant Library Amplification Kit amplify longer templates?
Equinox Uracil Tolerant Library Amplification Kits can robustly amplify templates up to 10 kb in length. We have shown efficient amplification >10 kb; however, we would recommend additional optimization.
What hot start mechanism is used for Equinox formulations and how well does it work?
A highly optimized hot start antibody is used to inhibit polymerase and exonuclease activity prior to the initial denaturation (enzyme activation) step. Equinox DNA Polymerase exhibits industry-leading inhibition of both polymerase and exonuclease activity prior to activation.
What are the cycling recommendations for the Equinox Library Amplification Kit?
Table 1: Thermocycler program settings
| Step | Temperature (°C) | Time (sec) | Cycles |
|---|---|---|---|
| Initial denaturation | 98 | 45 | 1 |
| Denaturation | 98 | 15 | See Table 2 |
| Annealing¹ | 60 | 30 | |
| Extension² | 72 | 30 | |
| Final extension | 60 | 1 | |
| Final hold | 4-12 | Hold | – |
- An annealing temperature of 60°C is recommended for standard Illumina® “P5” and “P7” primers (P5: AATGATACGGCGACCACCGA; P7: CAAGCAGAAGACGGCATACGAGAT). For other amplification primers, the optimal annealing temperature should be determined empirically in an annealing temperature gradient (55°C – 70°C) experiment.
- Longer extension times may be employed to ensure efficient amplification of longer-insert libraries. A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp; a 45 sec extension time is recommended for libraries with mode fragment sizes >500 bp. The optimal condition for each application may need to be determined empirically.
Table 2: Recommended PCR cycle numbers based on DNA input
| Adapter-ligated DNA (ng) | PCR cycles to generate | |
|---|---|---|
| 40 nM library | 1 µg library | |
| 500 | 1 | 2 |
| 100 | 3 | 4 |
| 50 | 4 | 5 |
| 10 | 7 | 8 |
| 5 | 8 | 9 |
| 1 | 11 | 12 |
| 0.5 | 12 | 13 |
| 0.1 | 15 | 16 |
| 0.01 | 18 | 19 |
| 0.001 | 22 | 23 |
| 0.0001 | 26 | 27 |
Is this kit compatible with other (non-Illumina) sequencing platforms?
This kit has been demonstrated to be compatible with Element, Singular and Ultima sequencing platforms.
What primer concentrations are recommended for amplification with the Equinox Library Amplification Kit?
Always use forward and reverse primers at the same final concentration of (0.5 to 2 µM each). A final concentration of 0.5 µM is sufficient to yield 500 ng of library (approximately 40 nM in a 50 µL reaction for a library with an average fragment length of 400 bp). If the total library yield must exceed 500 ng or 40 nM, use 2 µM final concentration. If you need more specific recommendations for primers, please contact support@watchmakergenomics.com.
What are the recommended extension times for amplification with the Equinox Library Amplification Kit?
A 30 sec extension is sufficient for libraries with a mode fragment size up to 500 bp. Longer extension times may be required to ensure efficient amplification of longer-insert libraries.
Besides NGS library amplification, for which applications would you recommend Equinox?
Please contact support@watchmakergenomics.com to inquire about other Equinox polymerase variants/formulations optimized for other applications.
Do you offer custom formats?
Yes! Watchmaker offers customer fills, packaging, concentrations, and labeling – including private label – designed to meet your unique needs. We offer flexible terms to serve organizations of any size, and our right-sized processes enable rapid turnaround time on customization. Please contact sales@watchmakergenomics.com to learn more about our capabilities.
Are you ISO 13485-certified?
Yes! Our Quality Management System has achieved ISO 13485:2016 Certification. Our certificate has been awarded for the design, development, manufacture, contract manufacture, and support of high performing reagents for genomics applications in medical research. Download the certificate here.
Not seeing the full table? Rotate your phone to view in landscape mode.
| Description | 24 rxn | 96 rxn | 384 rxn | |
|---|---|---|---|---|
| Equinox® Library Amplification Kit incl. P5/P7 Primer Mix (10x) | 7K0014-024 | 7K0014-096 | 7K0014-384 | Request a quote |
| Equinox Library Amplification Kit (w/o primers) | 7K0021-024 | 7K0021-096 | 7K0021-384 | Request a quote |
| Equinox HC Library Amplification Kit incl. P5/P7 Primer Mix (10x) | - | 7K0094-096 | 7K0094-384 | Request a quote |
| Equinox HC Library Amplification Kit (w/o primers) | - | 7K0065-096 | 7K0065-384 | Request a quote |
| Equinox Uracil Tolerant Amplification Kit incl. P5/P7 Primer Mix (10x) | 7K0023-024 | 7K0023-096 | 7K0023-384 | Request a quote |
| Equinox Uracil Tolerant Amplification Kit (w/o primers) | 7K0028-024 | 7K0028-096 | 7K0028-384 | Request a quote |
Please contact sales@watchmakergenomics.com to inquire about custom kit configurations.
Discover more with Watchmaker
DNA Library Prep Solutions
Rapid workflows to address all sample types and yield high conversion rates, reduced bias and artifacts, and reproducible results...
RNA Library Prep Solutions
Highly sensitive, scalable, and robust chemistry with respect to performance with challenging clinically relevant sample types, such as FFPE and low inputs...
DNA Library Prep Kits with TAPS+
Direct 5mC detection for improved coverage and multimodal insights. Compatible with degraded and low inputs ...
For assay developers – make realizing your next product easier
- Navigate the complexities of productization with an experienced team who’s as committed to your success as you are
- All aspects of our customization process are designed to serve you with speed, agility, and above all else, a commitment to quality
- Tailored fill volumes, labeling (including white and private label), and packaging designed to your specifications
- All products are manufactured within an ISO 13485:2016-certified QMS (download our certificate)
- Home
- Enzymes and Proteins
- DNA Polymerases
- Equinox Library Amplification



Validate your login